Product Details

SNP ID: rs4696323
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:152536889 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTTGAGTACAGAGTCACAACCTGAG[G/T]CTTTAGTGGAAAAGGAGACGAAATG
Phenotype: MIM: 606278
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DKFZP434I0714 PubMed Links

Gene Details

Gene: DKFZP434I0714
Gene Name: uncharacterized protein DKFZP434I0714

There are no transcripts associated with this gene.

Gene: FBXW7
Gene Name: F-box and WD repeat domain containing 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013415.1		Intron			NP_001013433.1
NM_001257069.1		Intron			NP_001243998.1
NM_018315.4		Intron			NP_060785.2
NM_033632.3		Intron			NP_361014.1
XM_011532083.1		Intron			XP_011530385.1
XM_011532084.1		Intron			XP_011530386.1
XM_011532085.1		Intron			XP_011530387.1
XM_011532086.1		Intron			XP_011530388.1
XM_011532087.1		Intron			XP_011530389.1
XM_011532088.1		Intron			XP_011530390.1
XM_017008362.1		Intron			XP_016863851.1

Gene: MIR4453
Gene Name: microRNA 4453

There are no transcripts associated with this gene.

View Full Product Details