Product Details
- SNP ID
-
rs5030656
- Assay Type
- DME
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:42128174 on Build GRCh38
- Set Membership
-
DME
Validated
Inventoried
- Context Sequence [VIC/FAM]
- CCCCACCGTGGCAGCCACTCTCAC[CTT/-]CTCCATCTCTGCCAGGAAGGCCTC
- Phenotype
-
MIM: 124030
- Polymorphism
- CTT/-, Insertion/deletion
- Allele Nomenclature
-
CYP2D6*9,g.2613_2615delAGA
CYP2D6*9,g. 2615_2617delAAG; CYP2D6*9,g.2613_2615delAGA
- Literature Links
-
CYP2D6
PubMed Links
- Additional Information
-
The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
For this assay, SNP(s) [rs28371721 and rs28371718] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance. For more information, refer to the assay Important Information note.
Gene Details
- Gene
- CYP2D6
- Gene Name
- cytochrome P450 family 2 subfamily D member 6
- Gene
- LOC102723722
- Gene Name
- uncharacterized LOC102723722
There are no transcripts associated with this gene.
- Gene
- NDUFA6-AS1
- Gene Name
- NDUFA6 antisense RNA 1 (head to head)
There are no transcripts associated with this gene.
View Full Product Details