Product Details

SNP ID: rs17374964
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:94209013 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGTGCCTAAAGACAACCTCTGTAC[A/C]CAAGGGAAGATCAGATCACATCAAG
Phenotype: MIM: 612761
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LOC101929210 PubMed Links

Gene Details

Gene: LOC101929210
Gene Name: uncharacterized LOC101929210

There are no transcripts associated with this gene.

Gene: SMARCAD1
Gene Name: SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001128429.2		Intron			NP_001121901.1
NM_001128430.1		Intron			NP_001121902.1
NM_001254949.1		Intron			NP_001241878.1
NM_020159.4		Intron			NP_064544.2
XM_017008463.1		Intron			XP_016863952.1
XM_017008464.1		Intron			XP_016863953.1
XM_017008465.1		Intron			XP_016863954.1

View Full Product Details