Product Details

SNP ID: rs17161726
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:99410772 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGTCTCTTAGGCACACATTATACAC[C/G]AGGCATGATAGATACAATTCTAATG
Phenotype: MIM: 603477 MIM: 607075 MIM: 614774
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ATP5J2-PTCD1 PubMed Links

Gene Details

Gene: ATP5J2-PTCD1
Gene Name: ATP5J2-PTCD1 readthrough

There are no transcripts associated with this gene.

Gene: BUD31
Gene Name: BUD31 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003910.3		Intron			NP_003901.2
XM_005250670.4		Intron			XP_005250727.1
XM_005250671.4		Intron			XP_005250728.1
XM_005250674.3		Intron			XP_005250731.1
XM_017012760.1		Intron			XP_016868249.1
XM_017012761.1		Intron			XP_016868250.1
XM_017012762.1		Intron			XP_016868251.1

Gene: PDAP1
Gene Name: PDGFA associated protein 1

There are no transcripts associated with this gene.

Gene: PTCD1
Gene Name: pentatricopeptide repeat domain 1

There are no transcripts associated with this gene.

View Full Product Details