Product Details

SNP ID: rs17853821
Assay Type: Functionally tested
NCBI dbSNP Submissions: 1
Location: Chr.1:156250628 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACTGCTTGTAGAAGTCCAGAACAT[C/T]CTTGATGTCCACACTGGCGTGGGCA
Phenotype: MIM: 112260 MIM: 614579 MIM: 610962
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BGLAP PubMed Links

Gene Details

Gene: BGLAP
Gene Name: bone gamma-carboxyglutamate protein

There are no transcripts associated with this gene.

Gene: PAQR6
Gene Name: progestin and adipoQ receptor family member 6

There are no transcripts associated with this gene.

Gene: PMF1-BGLAP
Gene Name: PMF1-BGLAP readthrough

There are no transcripts associated with this gene.

Gene: SMG5
Gene Name: SMG5, nonsense mediated mRNA decay factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001323614.1	3105	Missense Mutation	AAT,GAT	N951D	NP_001310543.1
NM_001323615.1	3105	Missense Mutation	AAT,GAT	N958D	NP_001310544.1
NM_001323616.1	3105	Missense Mutation	AAT,GAT	N938D	NP_001310545.1
NM_001323617.1	3105	Missense Mutation	AAT,GAT	N938D	NP_001310546.1
NM_015327.2	3105	Missense Mutation	AAT,GAT	N1004D	NP_056142.2
XM_017000842.1	3105	Missense Mutation	AAT,GAT	N792D	XP_016856331.1
XM_017000843.1	3105	Missense Mutation	AAT,GAT	N743D	XP_016856332.1

View Full Product Details