Product Details

SNP ID

rs16831960

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.2:189752974 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

AGAAGTTACTTGCGACACCACCAGA[C/T]GCAACCTGAAGGAATTGAGAAAACC

Phenotype

MIM: 609803

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ANKAR PubMed Links

Gene Details

Gene

ANKAR

Gene Name

ankyrin and armadillo repeat containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144708.3	1086	Intron			NP_653309.3
XM_011510673.2	1086	Intron			XP_011508975.1
XM_011510674.1	1086	Intron			XP_011508976.1
XM_011510675.2	1086	Intron			XP_011508977.1
XM_011510676.2	1086	Intron			XP_011508978.1
XM_011510677.2	1086	Intron			XP_011508979.1
XM_011510679.2	1086	Intron			XP_011508981.1
XM_011510680.1	1086	Intron			XP_011508982.1
XM_011510681.1	1086	Intron			XP_011508983.1
XM_011510682.2	1086	Intron			XP_011508984.1
XM_011510685.2	1086	Intron			XP_011508987.1
XM_011510686.2	1086	Intron			XP_011508988.1
XM_011510687.2	1086	Intron			XP_011508989.1
XM_011510688.1	1086	Intron			XP_011508990.1
XM_011510689.2	1086	Intron			XP_011508991.1
XM_011510691.2	1086	Intron			XP_011508993.1
XM_011510692.2	1086	Intron			XP_011508994.1
XM_011510693.2	1086	Intron			XP_011508995.1
XM_011510694.2	1086	Intron			XP_011508996.1
XM_017003413.1	1086	Intron			XP_016858902.1
XM_017003414.1	1086	Intron			XP_016858903.1
XM_017003415.1	1086	Intron			XP_016858904.1
XM_017003416.1	1086	Intron			XP_016858905.1
XM_017003417.1	1086	Intron			XP_016858906.1
XM_017003418.1	1086	Intron			XP_016858907.1
XM_017003419.1	1086	Intron			XP_016858908.1
XM_017003420.1	1086	Intron			XP_016858909.1

Gene

OSGEPL1

Gene Name

O-sialoglycoprotein endopeptidase-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022353.2	1086	Silent Mutation	GCA,GCG	A323A	NP_071748.2
XM_005246766.3	1086	Silent Mutation	GCA,GCG	A323A	XP_005246823.1
XM_006712685.1	1086	Silent Mutation	GCA,GCG	A323A	XP_006712748.1
XM_006712686.1	1086	Silent Mutation	GCA,GCG	A176A	XP_006712749.1
XM_011511631.1	1086	Silent Mutation	GCA,GCG	A323A	XP_011509933.1
XM_017004676.1	1086	Silent Mutation	GCA,GCG	A323A	XP_016860165.1
XM_017004677.1	1086	Silent Mutation	GCA,GCG	A323A	XP_016860166.1
XM_017004678.1	1086	Silent Mutation	GCA,GCG	A323A	XP_016860167.1
XM_017004679.1	1086	Silent Mutation	GCA,GCG	A323A	XP_016860168.1
XM_017004680.1	1086	Silent Mutation	GCA,GCG	A323A	XP_016860169.1
XM_017004681.1	1086	Silent Mutation	GCA,GCG	A176A	XP_016860170.1
XM_017004682.1	1086	Silent Mutation	GCA,GCG	A176A	XP_016860171.1
XM_017004683.1	1086	Silent Mutation	GCA,GCG	A176A	XP_016860172.1
XM_017004684.1	1086	Silent Mutation	GCA,GCG	A176A	XP_016860173.1
XM_017004685.1	1086	Silent Mutation	GCA,GCG	A176A	XP_016860174.1

Gene

OSGEPL1-AS1

Gene Name

OSGEPL1 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details