Product Details

SNP ID

rs17853265

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.10:73815240 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGGTATGGATAGGCTTGCTGTTCTT[G/T]GACAGGACTGCAGGGCAGGGTGGGG

Phenotype

MIM: 602123 MIM: 603268

Polymorphism

G/T, Transversion substitution

Allele Nomenclature

Literature Links

CAMK2G PubMed Links

Gene Details

Gene

CAMK2G

Gene Name

calcium/calmodulin dependent protein kinase II gamma

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204492.1	1486	Silent Mutation			NP_001191421.1
NM_001222.3	1486	Silent Mutation			NP_001213.2
NM_001320898.1	1486	Intron			NP_001307827.1
NM_172169.2	1486	Silent Mutation			NP_751909.1
NM_172170.4	1486	Silent Mutation			NP_751910.1
NM_172171.2	1486	Silent Mutation			NP_751911.1
NM_172173.2	1486	Silent Mutation			NP_751913.1
XM_005270195.1	1486	Silent Mutation			XP_005270252.1
XM_005270197.1	1486	Silent Mutation			XP_005270254.1
XM_005270198.1	1486	Silent Mutation			XP_005270255.1
XM_005270199.1	1486	Silent Mutation			XP_005270256.1
XM_005270200.1	1486	Silent Mutation			XP_005270257.1
XM_005270201.1	1486	Silent Mutation			XP_005270258.1
XM_005270203.1	1486	Silent Mutation			XP_005270260.1
XM_005270205.1	1486	Silent Mutation			XP_005270262.1
XM_006717993.1	1486	Silent Mutation			XP_006718056.1
XM_006717996.1	1486	Silent Mutation			XP_006718059.1
XM_006717997.1	1486	Silent Mutation			XP_006718060.1
XM_006717998.1	1486	Silent Mutation			XP_006718061.1
XM_011540225.2	1486	Intron			XP_011538527.1
XM_017016716.1	1486	Intron			XP_016872205.1
XM_017016717.1	1486	Intron			XP_016872206.1
XM_017016718.1	1486	Intron			XP_016872207.1
XM_017016719.1	1486	Intron			XP_016872208.1
XM_017016720.1	1486	Intron			XP_016872209.1
XM_017016721.1	1486	Intron			XP_016872210.1
XM_017016722.1	1486	Intron			XP_016872211.1
XM_017016723.1	1486	Intron			XP_016872212.1
XM_017016724.1	1486	Intron			XP_016872213.1
XM_017016725.1	1486	Intron			XP_016872214.1
XM_017016726.1	1486	Intron			XP_016872215.1
XM_017016727.1	1486	Intron			XP_016872216.1
XM_017016728.1	1486	Silent Mutation			XP_016872217.1
XM_017016729.1	1486	Intron			XP_016872218.1
XM_017016730.1	1486	Silent Mutation			XP_016872219.1
XM_017016731.1	1486	Intron			XP_016872220.1
XM_017016732.1	1486	Intron			XP_016872221.1
XM_017016733.1	1486	Silent Mutation			XP_016872222.1
XM_017016734.1	1486	Intron			XP_016872223.1
XM_017016735.1	1486	Silent Mutation			XP_016872224.1
XM_017016736.1	1486	Silent Mutation			XP_016872225.1
XM_017016737.1	1486	Intron			XP_016872226.1
XM_017016738.1	1486	Intron			XP_016872227.1
XM_017016739.1	1486	Intron			XP_016872228.1

Gene

NDST2

Gene Name

N-deacetylase and N-sulfotransferase 2

There are no transcripts associated with this gene.

View Full Product Details