Product Details

SNP ID: rs11556013
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:68032952 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGAACATGCAGGATCCCGAGATG[G/T]ACATGAAGTCAGTGACTGACCGGGC
Phenotype: MIM: 600466 MIM: 602141 MIM: 604592
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ALDH3B1 PubMed Links

Gene Details

Gene: ALDH3B1
Gene Name: aldehyde dehydrogenase 3 family member B1

There are no transcripts associated with this gene.

Gene: MIR4691
Gene Name: microRNA 4691

There are no transcripts associated with this gene.

Gene: MIR7113
Gene Name: microRNA 7113

There are no transcripts associated with this gene.

Gene: NDUFS8
Gene Name: NADH:ubiquinone oxidoreductase core subunit S8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002496.3	353	Missense Mutation	GAC,TAC	D47Y	NP_002487.1
XM_005274013.1	353	Missense Mutation	GAC,TAC	D47Y	XP_005274070.1
XM_005274014.2	353	Missense Mutation	GAC,TAC	D47Y	XP_005274071.1
XM_011545053.2	353	Missense Mutation	GAC,TAC	D47Y	XP_011543355.1

Gene: TCIRG1
Gene Name: T-cell immune regulator 1, ATPase H+ transporting V0 subunit a3

There are no transcripts associated with this gene.

View Full Product Details