Product Details

SNP ID: rs28435606
Assay Type: Functionally tested
NCBI dbSNP Submissions: 10
Location: Chr.1:153540873 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCCAAAACCTGGATCCAGAGGCTA[C/T]GCTTGAATAAGGGCCTGGATTCCAA
Phenotype: MIM: 176992 MIM: 114210 MIM: 176991 MIM: 114110
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LOC101928034 PubMed Links

Gene Details

Gene: LOC101928034
Gene Name: uncharacterized LOC101928034

There are no transcripts associated with this gene.

Gene: S100A3
Gene Name: S100 calcium binding protein A3

There are no transcripts associated with this gene.

Gene: S100A4
Gene Name: S100 calcium binding protein A4

There are no transcripts associated with this gene.

Gene: S100A5
Gene Name: S100 calcium binding protein A5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002962.1	506	Intron			NP_002953.2
XM_011509860.2	506	UTR 5			XP_011508162.1
XM_017002029.1	506	Intron			XP_016857518.1
XM_017002030.1	506	Intron			XP_016857519.1
XM_017002031.1	506	UTR 5			XP_016857520.1
XM_017002032.1	506	UTR 5			XP_016857521.1

Gene: S100A6
Gene Name: S100 calcium binding protein A6

There are no transcripts associated with this gene.

View Full Product Details