Product Details

SNP ID: rs3093566
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:25338442 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGACACCGGGCTCCGGAACCACTGC[A/T]CGACGGGGCTGGACGTAAGTGTCGG
Phenotype: MIM: 111680 MIM: 605348
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: RHD PubMed Links

Gene Details

Gene: RHD
Gene Name: Rh blood group D antigen

There are no transcripts associated with this gene.

Gene: RSRP1
Gene Name: arginine and serine rich protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321772.1	145	Intron			NP_001308701.1
NM_020317.4	145	Intron			NP_064713.3
XM_011541797.1	145	Intron			XP_011540099.1

Gene: TMEM50A
Gene Name: transmembrane protein 50A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014313.3	145	UTR 5			NP_055128.1
XM_005245817.1	145	UTR 5			XP_005245874.1
XM_011541159.1	145	Intron			XP_011539461.1

View Full Product Details