Product Details
- SNP ID
-
rs4589167
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
38
- Location
-
Chr.1:235121267 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTTTGGTCCTTGAATTACACTGTAC[A/G]TACTCTTATTAACCTAGCCAACACA
- Phenotype
-
MIM: 601848
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
RBM34
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs139546030] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- RBM34
- Gene Name
- RNA binding motif protein 34
There are no transcripts associated with this gene.
- Gene
- SNORA14B
- Gene Name
- small nucleolar RNA, H/ACA box 14B
There are no transcripts associated with this gene.
- Gene
- TOMM20
- Gene Name
- translocase of outer mitochondrial membrane 20
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_014765.2 |
|
Intron |
|
|
NP_055580.1 |
View Full Product Details