Product Details

SNP ID

rs11963013

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.6:42226542 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TTTCTGAAATGGCAGCAAATGAAAC[C/T]TTTTTCCCCCTCTAAACAAAAGATG

Phenotype

MIM: 611976 MIM: 610322

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

MRPS10 PubMed Links

Additional Information

For this assay, SNP(s) [rs575434952] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MRPS10

Gene Name

mitochondrial ribosomal protein S10

There are no transcripts associated with this gene.

Gene

TRERF1

Gene Name

transcriptional regulating factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297573.1	6453	UTR 3			NP_001284502.1
NM_033502.3	6453	UTR 3			NP_277037.1
XM_011514741.2	6453	UTR 3			XP_011513043.1
XM_011514742.2	6453	UTR 3			XP_011513044.1
XM_011514743.2	6453	UTR 3			XP_011513045.1
XM_011514744.1	6453	UTR 3			XP_011513046.1
XM_011514745.1	6453	UTR 3			XP_011513047.1
XM_017011034.1	6453	UTR 3			XP_016866523.1
XM_017011035.1	6453	UTR 3			XP_016866524.1
XM_017011036.1	6453	UTR 3			XP_016866525.1
XM_017011037.1	6453	UTR 3			XP_016866526.1
XM_017011038.1	6453	UTR 3			XP_016866527.1
XM_017011039.1	6453	UTR 3			XP_016866528.1
XM_017011040.1	6453	UTR 3			XP_016866529.1
XM_017011041.1	6453	UTR 3			XP_016866530.1
XM_017011042.1	6453	UTR 3			XP_016866531.1
XM_017011043.1	6453	UTR 3			XP_016866532.1
XM_017011044.1	6453	UTR 3			XP_016866533.1
XM_017011045.1	6453	UTR 3			XP_016866534.1
XM_017011046.1	6453	UTR 3			XP_016866535.1
XM_017011047.1	6453	UTR 3			XP_016866536.1
XM_017011048.1	6453	UTR 3			XP_016866537.1
XM_017011049.1	6453	UTR 3			XP_016866538.1
XM_017011050.1	6453	UTR 3			XP_016866539.1
XM_017011051.1	6453	UTR 3			XP_016866540.1
XM_017011052.1	6453	UTR 3			XP_016866541.1
XM_017011053.1	6453	UTR 3			XP_016866542.1
XM_017011054.1	6453	UTR 3			XP_016866543.1
XM_017011055.1	6453	UTR 3			XP_016866544.1

View Full Product Details