Product Details
- SNP ID
-
rs28667006
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.15:88611723 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGGAGAGGTGTTCAAAGATGAACTT[A/G]GTAATAGGAGCGGAGACAACGCCTC
- Phenotype
-
MIM: 610177
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
AEN
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs111791075] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- AEN
- Gene Name
- apoptosis enhancing nuclease
- Gene
- LINC01586
- Gene Name
- long intergenic non-protein coding RNA 1586
There are no transcripts associated with this gene.
- Gene
- MIR1179
- Gene Name
- microRNA 1179
There are no transcripts associated with this gene.
- Gene
- MIR3529
- Gene Name
- microRNA 3529
There are no transcripts associated with this gene.
- Gene
- MIR7-2
- Gene Name
- microRNA 7-2
There are no transcripts associated with this gene.
View Full Product Details