Product Details

SNP ID: rs28362601
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:29820482 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGGTGAGAGTTCCCCATCTGAGGC[A/G]TTTGTTGCAGCTACCTGCACTTCTA
Phenotype: MIM: 600999 MIM: 605088 MIM: 612033 MIM: 614386
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MAZ PubMed Links

Gene Details

Gene: MAZ
Gene Name: MYC associated zinc finger protein

There are no transcripts associated with this gene.

Gene: MVP
Gene Name: major vault protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001293204.1	1812	Intron			NP_001280133.1
NM_001293205.1	1812	Intron			NP_001280134.1
NM_005115.4	1812	UTR 5			NP_005106.2
NM_017458.3	1812	UTR 5			NP_059447.2

Gene: PAGR1
Gene Name: PAXIP1 associated glutamate rich protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024516.3	1812	UTR 3			NP_078792.1

Gene: PRRT2
Gene Name: proline rich transmembrane protein 2

There are no transcripts associated with this gene.

View Full Product Details