Product Details
- SNP ID
-
rs6789792
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:46211399 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AATATGTATATATATATATATATAT[A/T]TTTTGTAGAAATGGGTGTGTTATCA
- Phenotype
-
MIM: 601159
MIM: 601268
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
CCR1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs371658993] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCR1
- Gene Name
- C-C motif chemokine receptor 1
There are no transcripts associated with this gene.
- Gene
- CCR3
- Gene Name
- C-C motif chemokine receptor 3
View Full Product Details