Product Details

SNP ID: rs35844464
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144099196 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATCTTCTGGGGGTGCTGAGGGCTA[C/G]GTCCTGTGGCTGAGGGGGTGGAGCT
Phenotype: MIM: 123980 MIM: 610210 MIM: 611885
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CYC1 PubMed Links

Gene Details

Gene: CYC1
Gene Name: cytochrome c1

There are no transcripts associated with this gene.

Gene: MAF1
Gene Name: MAF1 homolog, negative regulator of RNA polymerase III

There are no transcripts associated with this gene.

Gene: SHARPIN
Gene Name: SHANK associated RH domain interactor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030974.3	1416	Missense Mutation	CCT,CGT	P311R	NP_112236.3
XM_017013887.1	1416	Missense Mutation	CCT,CGT	P309R	XP_016869376.1
XM_017013888.1	1416	Intron			XP_016869377.1

Gene: WDR97
Gene Name: WD repeat domain 97

There are no transcripts associated with this gene.

View Full Product Details