Product Details

SNP ID

rs35538974

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.14:102139571 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

AGGCTCATGACACCAGCCCCGCCGC[A/G]GTTCCCCCTGACCGGCTTTCCGCTG

Phenotype

MIM: 140571

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

HSP90AA1 PubMed Links

Additional Information

For this assay, SNP(s) [rs116641992] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

HSP90AA1

Gene Name

heat shock protein 90 alpha family class A member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001017963.2	54	UTR 5			NP_001017963.2
NM_005348.3	54	Intron			NP_005339.3
XM_011536718.2	54	UTR 5			XP_011535020.1

Gene

WDR20

Gene Name

WD repeat domain 20

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242414.1	54	Intron			NP_001229343.1
NM_001242415.1	54	Intron			NP_001229344.1
NM_001242416.1	54	Intron			NP_001229345.1
NM_001242417.1	54	Intron			NP_001229346.1
NM_001242418.1	54	Intron			NP_001229347.1
NM_001320130.1	54	Intron			NP_001307059.1
NM_144574.3	54	Intron			NP_653175.2
NM_181291.2	54	Intron			NP_851808.1
NM_181308.2	54	Intron			NP_851825.1
XM_006720308.1	54	Intron			XP_006720371.1
XM_006720309.1	54	Intron			XP_006720372.1
XM_006720310.1	54	Intron			XP_006720373.1
XM_006720311.1	54	Intron			XP_006720374.1
XM_006720313.2	54	Intron			XP_006720376.1
XM_006720318.2	54	Intron			XP_006720381.1
XM_006720320.3	54	Intron			XP_006720383.1
XM_011537335.2	54	Intron			XP_011535637.1
XM_011537336.2	54	Intron			XP_011535638.1
XM_011537337.2	54	Intron			XP_011535639.1
XM_011537338.1	54	Intron			XP_011535640.1
XM_011537339.2	54	Intron			XP_011535641.1
XM_011537340.2	54	Intron			XP_011535642.1
XM_011537341.2	54	Intron			XP_011535643.1
XM_011537343.1	54	Intron			XP_011535645.1
XM_011537344.2	54	Intron			XP_011535646.1
XM_011537345.1	54	Intron			XP_011535647.1
XM_011537346.1	54	Intron			XP_011535648.1
XM_011537347.1	54	Intron			XP_011535649.1
XM_011537352.2	54	Intron			XP_011535654.1
XM_011537353.2	54	Intron			XP_011535655.1
XM_011537355.2	54	Intron			XP_011535657.1
XM_011537356.2	54	Intron			XP_011535658.1
XM_011537358.2	54	Intron			XP_011535660.1
XM_017021766.1	54	Intron			XP_016877255.1
XM_017021767.1	54	Intron			XP_016877256.1
XM_017021768.1	54	Intron			XP_016877257.1
XM_017021770.1	54	Intron			XP_016877259.1
XM_017021771.1	54	Intron			XP_016877260.1
XM_017021772.1	54	Intron			XP_016877261.1
XM_017021773.1	54	Intron			XP_016877262.1
XM_017021774.1	54	Intron			XP_016877263.1
XM_017021775.1	54	Intron			XP_016877264.1
XM_017021776.1	54	Intron			XP_016877265.1
XM_017021777.1	54	Intron			XP_016877266.1
XM_017021778.1	54	Intron			XP_016877267.1
XM_017021779.1	54	Intron			XP_016877268.1
XM_017021780.1	54	UTR 5			XP_016877269.1
XM_017021781.1	54	Intron			XP_016877270.1
XM_017021782.1	54	Intron			XP_016877271.1
XM_017021783.1	54	Intron			XP_016877272.1
XM_017021784.1	54	Intron			XP_016877273.1
XM_017021785.1	54	Intron			XP_016877274.1

View Full Product Details