Product Details
- SNP ID
-
rs17886118
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
25
- Location
-
Chr.1:44806240 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCTCCCGCACCAGCCGCGCGGCCTC[A/G]TCGCTGGAGTAGCACGCGTCGTGCA
- Phenotype
-
MIM: 602913
MIM: 611713
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
BTBD19
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs17885815] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- BTBD19
- Gene Name
- BTB domain containing 19
There are no transcripts associated with this gene.
- Gene
- PLK3
- Gene Name
- polo like kinase 3
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_004073.3 |
572 |
Intron |
|
|
NP_004064.2 |
- Gene
- TCTEX1D4
- Gene Name
- Tctex1 domain containing 4
View Full Product Details