Product Details

SNP ID: rs3186794
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65112819 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCCTTGGACCCGCAGGTGGCCGA[A/G]GGGCAGGAATTGAAGGACAAGAGTC
Phenotype: MIM: 134690 MIM: 606866 MIM: 603414 MIM: 615738 MIM: 604575
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAU PubMed Links

Gene Details

Gene: FAU
Gene Name: FAU, ubiquitin like and ribosomal protein S30 fusion

There are no transcripts associated with this gene.

Gene: MRPL49
Gene Name: mitochondrial ribosomal protein L49

There are no transcripts associated with this gene.

Gene: TM7SF2
Gene Name: transmembrane 7 superfamily member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001277233.1	420	Silent Mutation	GAA,GAG	E86E	NP_001264162.1
NM_003273.3	420	Silent Mutation	GAA,GAG	E86E	NP_003264.2

Gene: VPS51
Gene Name: VPS51, GARP complex subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013265.3	420	Intron			NP_037397.2

Gene: ZNHIT2
Gene Name: zinc finger HIT-type containing 2

There are no transcripts associated with this gene.

View Full Product Details