Product Details

SNP ID: rs57433624
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144106895 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTGGACATGGAGCTGGGGGAGGA[A/G]GAGGTGGAGGAAGAAAGCAGAAGCG
Phenotype: MIM: 123980 MIM: 610210 MIM: 611885
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CYC1 PubMed Links

Gene Details

Gene: CYC1
Gene Name: cytochrome c1

There are no transcripts associated with this gene.

Gene: MAF1
Gene Name: MAF1 homolog, negative regulator of RNA polymerase III

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032272.4	1305	Silent Mutation	GAA,GAG	E227E	NP_115648.2
XM_017013903.1	1305	Silent Mutation	GAA,GAG	E227E	XP_016869392.1
XM_017013904.1	1305	Intron			XP_016869393.1

Gene: SHARPIN
Gene Name: SHANK associated RH domain interactor

There are no transcripts associated with this gene.

Gene: WDR97
Gene Name: WD repeat domain 97

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316309.1	1305	Intron			NP_001303238.1
XM_017013385.1	1305	Intron			XP_016868874.1
XM_017013386.1	1305	Intron			XP_016868875.1
XM_017013387.1	1305	Intron			XP_016868876.1
XM_017013388.1	1305	Intron			XP_016868877.1
XM_017013389.1	1305	Intron			XP_016868878.1
XM_017013390.1	1305	Intron			XP_016868879.1
XM_017013391.1	1305	Intron			XP_016868880.1
XM_017013392.1	1305	Intron			XP_016868881.1
XM_017013393.1	1305	Intron			XP_016868882.1
XM_017013394.1	1305	Intron			XP_016868883.1

View Full Product Details