Product Details

SNP ID: rs41304832
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63744155 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTAAGTATGGCTTTCTTAAGAGTC[A/G]CACATGTCACAGAATGAGCTAAAAT
Phenotype: MIM: 609809 MIM: 609493 MIM: 614639
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LIME1 PubMed Links

Gene Details

Gene: LIME1
Gene Name: Lck interacting transmembrane adaptor 1

There are no transcripts associated with this gene.

Gene: SLC2A4RG
Gene Name: SLC2A4 regulator

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020062.3	4826	Intron			NP_064446.2

Gene: ZBTB46
Gene Name: zinc finger and BTB domain containing 46

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025224.3	4826	UTR 3			NP_079500.2
XM_005260195.4	4826	UTR 3			XP_005260252.1
XM_005260196.3	4826	UTR 3			XP_005260253.1
XM_005260197.4	4826	UTR 3			XP_005260254.1
XM_005260198.4	4826	UTR 3			XP_005260255.1
XM_006723700.3	4826	UTR 3			XP_006723763.1
XM_011528548.2	4826	UTR 3			XP_011526850.1
XM_011528549.2	4826	Intron			XP_011526851.1
XM_017027667.1	4826	Intron			XP_016883156.1

Gene: ZGPAT
Gene Name: zinc finger CCCH-type and G-patch domain containing

There are no transcripts associated with this gene.

View Full Product Details