Product Details

SNP ID
rs41276537
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.3:48689678 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TTGAGGTCAAGGACACAAGGCACCT[C/T]GTAGCGGGAAGTCAGGTTTTCCAGT
Phenotype
MIM: 606992 MIM: 606671
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
IP6K2 PubMed Links
Additional Information
For this assay, SNP(s) [rs4858798] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
IP6K2
Gene Name
inositol hexakisphosphate kinase 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001005909.2 892 Missense Mutation AAG,GAG K214E NP_001005909.1
NM_001005910.2 892 Intron NP_001005910.1
NM_001005911.2 892 Intron NP_001005911.1
NM_001146178.2 892 Intron NP_001139650.1
NM_001146179.2 892 Intron NP_001139651.1
NM_001190316.1 892 Intron NP_001177245.1
NM_001190317.1 892 Intron NP_001177246.1
NM_016291.3 892 Missense Mutation AAG,GAG K214E NP_057375.2
XM_006713199.3 892 Missense Mutation AAG,GAG K273E XP_006713262.1
XM_006713200.1 892 Missense Mutation AAG,GAG K272E XP_006713263.1
XM_006713201.1 892 Missense Mutation AAG,GAG K269E XP_006713264.1
XM_006713202.1 892 Missense Mutation AAG,GAG K268E XP_006713265.1
XM_011533816.1 892 Missense Mutation AAG,GAG K268E XP_011532118.1
XM_011533817.1 892 Missense Mutation AAG,GAG K176E XP_011532119.1
XM_011533818.1 892 Missense Mutation AAG,GAG K176E XP_011532120.1
XM_011533822.1 892 Intron XP_011532124.1
XM_011533823.1 892 Intron XP_011532125.1
XM_017006583.1 892 Missense Mutation AAG,GAG K214E XP_016862072.1
XM_017006584.1 892 Missense Mutation AAG,GAG K214E XP_016862073.1
XM_017006585.1 892 Missense Mutation AAG,GAG K214E XP_016862074.1
XM_017006586.1 892 Missense Mutation AAG,GAG K176E XP_016862075.1
XM_017006587.1 892 Missense Mutation AAG,GAG K176E XP_016862076.1
XM_017006588.1 892 Intron XP_016862077.1
XM_017006589.1 892 Intron XP_016862078.1
XM_017006590.1 892 Intron XP_016862079.1
XM_017006591.1 892 Intron XP_016862080.1
XM_017006592.1 892 Intron XP_016862081.1
XM_017006593.1 892 Intron XP_016862082.1
Gene
NCKIPSD
Gene Name
NCK interacting protein with SH3 domain
There are no transcripts associated with this gene.

View Full Product Details