Product Details

SNP ID: rs45585533
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64314314 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGGAGGTGGACCCACTGCCCTTCC[A/C]GGGCCCCTTCCCTGCTGGGCCCCTG
Phenotype: MIM: 601998 MIM: 606583
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ESRRA PubMed Links

Gene Details

Gene: ESRRA
Gene Name: estrogen related receptor alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282450.1	739	Intron			NP_001269379.1
NM_001282451.1	739	Missense Mutation	CAG,CCG	Q173P	NP_001269380.1
NM_004451.4	739	Missense Mutation	CAG,CCG	Q173P	NP_004442.3
XM_017017313.1	739	Missense Mutation	CAG,CCG	Q183P	XP_016872802.1

Gene: KCNK4-TEX40
Gene Name: KCNK4-TEX40 readthrough

There are no transcripts associated with this gene.

Gene: PRDX5
Gene Name: peroxiredoxin 5

There are no transcripts associated with this gene.

Gene: TEX40
Gene Name: testis expressed 40

There are no transcripts associated with this gene.

Gene: TRMT112
Gene Name: tRNA methyltransferase 11-2 homolog (S. cerevisiae)

There are no transcripts associated with this gene.

View Full Product Details