Product Details
- SNP ID
-
rs41314629
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.10:1019517 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ATGGCTGACTCGACCTCCCTGCCTC[A/T]CACACTCTGTGTATTTTGTGAAGCT
- Phenotype
-
MIM: 615389
MIM: 615391
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
GTPBP4
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs17851563] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- GTPBP4
- Gene Name
- GTP binding protein 4
There are no transcripts associated with this gene.
- Gene
- IDI2
- Gene Name
- isopentenyl-diphosphate delta isomerase 2
There are no transcripts associated with this gene.
- Gene
- IDI2-AS1
- Gene Name
- IDI2 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details