Product Details

SNP ID: rs58009529
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7225853 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCAGGAGCGCCCGGCCCAGCCTGG[C/G]CCCACAGTGGGCTACATAACATCCA
Phenotype: MIM: 609575 MIM: 602887 MIM: 602151 MIM: 612910
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ACADVL PubMed Links

Gene Details

Gene: ACADVL
Gene Name: acyl-CoA dehydrogenase, very long chain

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000018.3	1851	Intron			NP_000009.1
NM_001033859.2	1851	Intron			NP_001029031.1
NM_001270447.1	1851	Intron			NP_001257376.1
NM_001270448.1	1851	Intron			NP_001257377.1
XM_006721516.2	1851	Intron			XP_006721579.2
XM_011523829.1	1851	Intron			XP_011522131.1
XM_011523830.1	1851	Intron			XP_011522132.1

Gene: DLG4
Gene Name: discs large MAGUK scaffold protein 4

There are no transcripts associated with this gene.

Gene: DVL2
Gene Name: dishevelled segment polarity protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004422.2	1851	UTR 3			NP_004413.1
XM_005256502.1	1851	UTR 3			XP_005256559.1
XM_017024298.1	1851	UTR 3			XP_016879787.1

Gene: MIR324
Gene Name: microRNA 324

There are no transcripts associated with this gene.

Gene: PHF23
Gene Name: PHD finger protein 23

There are no transcripts associated with this gene.

View Full Product Details