Product Details
- SNP ID
-
rs59721087
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.3:46742147 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTGGTCCCAGATTCCAGAATCCTTC[C/T]AGGCCACACTTCCCTTCTCCTGCTC
- Phenotype
-
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PRSS45
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs112576071] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PRSS45
- Gene Name
- protease, serine 45
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_199183.2 |
890 |
UTR 3 |
|
|
NP_954652.2 |
- Gene
- PRSS46
- Gene Name
- protease, serine 46
There are no transcripts associated with this gene.
View Full Product Details