Product Details

SNP ID: hCV90512953
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:75400714 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTAGTTTGTCGCTGATGGCATCTT[C/T]AAAGCTGAACTGAATGAGTTTCTTA
Phenotype: MIM: 600454 MIM: 600455
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: RPS3 PubMed Links

Gene Details

Gene: RPS3
Gene Name: ribosomal protein S3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005.4	108	Silent Mutation	TTC,TTT	F17F	NP_000996.2
NM_001256802.1	108	Silent Mutation	TTC,TTT	F17F	NP_001243731.1
NM_001260506.1	108	Silent Mutation	TTC,TTT	F17F	NP_001247435.1
NM_001260507.1	108	Intron			NP_001247436.1

Gene: SNORD15A
Gene Name: small nucleolar RNA, C/D box 15A

There are no transcripts associated with this gene.

Gene: SNORD15B
Gene Name: small nucleolar RNA, C/D box 15B

There are no transcripts associated with this gene.

View Full Product Details