Product Details

SNP ID: rs67312806
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:9232415 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGGTTGTGCTGTACTCCCCTGGAA[C/T]CTCTGGCAACTGGACCTCCTGCAGC
Phenotype: MIM: 604874
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: A2MP1 PubMed Links

Gene Details

Gene: A2MP1
Gene Name: alpha-2-macroglobulin pseudogene 1

There are no transcripts associated with this gene.

Gene: KLRG1
Gene Name: killer cell lectin like receptor G1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005810.3		Intron			NP_005801.3
XM_017018682.1		Intron			XP_016874171.1
XM_017018683.1		Intron			XP_016874172.1
XM_017018684.1		Intron			XP_016874173.1
XM_017018685.1		Intron			XP_016874174.1

Gene: LINC00987
Gene Name: long intergenic non-protein coding RNA 987

There are no transcripts associated with this gene.

Gene: MIR1244-3
Gene Name: microRNA 1244-3

There are no transcripts associated with this gene.

View Full Product Details