Product Details

SNP ID: rs73556588
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:43623390 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCTGCCATTGAGGAAGGCTTCTCT[G/T]GCTTCTCCCTGTTCATCCAAGCCAC
Phenotype: MIM: 609744
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CADM4 PubMed Links

Gene Details

Gene: CADM4
Gene Name: cell adhesion molecule 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145296.1	1065	Silent Mutation	GCA,GCC	A369A	NP_660339.1
XM_005258620.2	1065	Silent Mutation	GCA,GCC	A326A	XP_005258677.1
XM_017026452.1	1065	Silent Mutation	GCA,GCC	A350A	XP_016881941.1

Gene: SRRM5
Gene Name: serine/arginine repetitive matrix 5

There are no transcripts associated with this gene.

Gene: ZNF428
Gene Name: zinc finger protein 428

There are no transcripts associated with this gene.

View Full Product Details