Product Details

SNP ID: rs73271573
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:140671809 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAACCCTGGGCCCAAGCCTCCAGGT[G/T]GTGAGCCCTTTGGAGCTACACAGTC
Phenotype: MIM: 609385 MIM: 142810 MIM: 600549
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: DND1 PubMed Links

Gene Details

Gene: DND1
Gene Name: DND microRNA-mediated repression inhibitor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_194249.2	1843	Intron			NP_919225.1

Gene: HARS
Gene Name: histidyl-tRNA synthetase

There are no transcripts associated with this gene.

Gene: IK
Gene Name: IK cytokine, down-regulator of HLA II

There are no transcripts associated with this gene.

Gene: WDR55
Gene Name: WD repeat domain 55

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017706.4	1843	Intron			NP_060176.2
XM_005268469.2	1843	UTR 3			XP_005268526.1
XM_017009600.1	1843	UTR 3			XP_016865089.1

View Full Product Details