Product Details

SNP ID: rs328298
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.8:38511188 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTTCAGAGGCACACTGTATGAGGAG[A/G]TCTGTTCATGCCCAGCAGCATCTTG
Phenotype
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: C8orf86 PubMed Links
Additional Information: For this assay, SNP(s) [rs80038579] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303531.1	1896	UTR 3			NP_001290460.1
NM_207412.2	1896	UTR 3			NP_997295.1