Product Details

SNP ID: rs11588779
Assay Type: Functionally tested
NCBI dbSNP Submissions: 72
Location: Chr.1:12022824 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTTAGTCCTTGTCCCTCTGTGCTTC[C/T]TTCCTCAGCCCAGGGTGACCTTCTC
Phenotype: MIM: 608507 MIM: 608772
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MFN2 PubMed Links

Gene Details

Gene: MFN2
Gene Name: mitofusin 2

There are no transcripts associated with this gene.

Gene: MIIP
Gene Name: migration and invasion inhibitory protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021933.3		Intron			NP_068752.2
XM_005263487.3		Intron			XP_005263544.1
XM_011541895.1		Intron			XP_011540197.1
XM_011541896.1		Intron			XP_011540198.1

Gene: MIR6729
Gene Name: microRNA 6729

There are no transcripts associated with this gene.

View Full Product Details