Product Details

SNP ID: rs1058808
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:39727784 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACCTGCTGGTGCCACTCTGGAAAGG[C/G]CCAAGACTCTCTCCCCAGGGAAGAA
Phenotype: MIM: 164870 MIM: 611802
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ERBB2 PubMed Links

Gene Details

Gene: ERBB2
Gene Name: erb-b2 receptor tyrosine kinase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005862.2	3994	Missense Mutation	CCC,GCC	P1140A	NP_001005862.1
NM_001289936.1	3994	Missense Mutation	CCC,GCC	P1155A	NP_001276865.1
NM_001289937.1	3994	UTR 3			NP_001276866.1
NM_001289938.1	3994	Intron			NP_001276867.1
NM_004448.3	3994	Missense Mutation	CCC,GCC	P1170A	NP_004439.2

Gene: MIEN1
Gene Name: migration and invasion enhancer 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032339.4	3994	Intron			NP_115715.3
XM_005257736.3	3994	Intron			XP_005257793.1

Gene: MIR4728
Gene Name: microRNA 4728

There are no transcripts associated with this gene.

View Full Product Details