Product Details

SNP ID: rs1047852
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1481560 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAGCCTCTCCCCCCAGCCCACTCC[C/T]GCCCAAACCCAAAATGCAGAGGAGA
Phenotype: MIM: 612034 MIM: 600487 MIM: 609346
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: APC2 PubMed Links

Gene Details

Gene: APC2
Gene Name: APC2, WNT signaling pathway regulator

There are no transcripts associated with this gene.

Gene: C19orf25
Gene Name: chromosome 19 open reading frame 25

There are no transcripts associated with this gene.

Gene: PCSK4
Gene Name: proprotein convertase subtilisin/kexin type 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017573.4	2131	UTR 3			NP_060043.2
XM_005259586.1	2131	UTR 3			XP_005259643.1
XM_011528085.2	2131	UTR 3			XP_011526387.1
XM_011528086.2	2131	UTR 3			XP_011526388.1
XM_011528087.2	2131	UTR 3			XP_011526389.1
XM_011528088.2	2131	UTR 3			XP_011526390.1
XM_011528089.2	2131	UTR 3			XP_011526391.1
XM_011528090.2	2131	UTR 3			XP_011526392.1
XM_011528091.2	2131	UTR 3			XP_011526393.1
XM_011528092.2	2131	Intron			XP_011526394.1
XM_011528093.2	2131	UTR 3			XP_011526395.1
XM_011528094.1	2131	UTR 3			XP_011526396.1
XM_011528095.2	2131	Intron			XP_011526397.1
XM_011528096.1	2131	UTR 3			XP_011526398.1
XM_017026897.1	2131	Intron			XP_016882386.1

Gene: REEP6
Gene Name: receptor accessory protein 6

There are no transcripts associated with this gene.

View Full Product Details