Product Details

SNP ID: rs2721197
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.8:144502322 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GCCTGGGCCTCACCCACTCCCTCCC[A/G]TGCTCAGCCTCCTGGAGCCTCCTCC
Phenotype: MIM: 138200 MIM: 609172 MIM: 603780
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GPT PubMed Links

Gene Details

Gene: GPT
Gene Name: glutamic--pyruvic transaminase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005309.2	106	Intron			NP_005300.1
XM_011516993.2	106	UTR 5			XP_011515295.1

Gene: LOC101928953
Gene Name: uncharacterized LOC101928953

There are no transcripts associated with this gene.

Gene: MFSD3
Gene Name: major facilitator superfamily domain containing 3

There are no transcripts associated with this gene.

Gene: PPP1R16A
Gene Name: protein phosphatase 1 regulatory subunit 16A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005272350.2	106	Intron			XP_005272407.1
XM_011517349.2	106	Intron			XP_011515651.1
XM_017013912.1	106	Intron			XP_016869401.1
XM_017013913.1	106	Intron			XP_016869402.1
XM_017013914.1	106	Intron			XP_016869403.1
XM_017013915.1	106	Intron			XP_016869404.1

Gene: RECQL4
Gene Name: RecQ like helicase 4

There are no transcripts associated with this gene.

View Full Product Details