Product Details

SNP ID: rs712958
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:19179896 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCCACTACACGCGGAAGTTGTACA[C/T]TGGAGGCTGGCGAAGTTGGGAGCAG
Phenotype: MIM: 601273 MIM: 190315
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CLTCL1 PubMed Links

Gene Details

Gene: CLTCL1
Gene Name: clathrin heavy chain like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001835.3	3326	UTR 3			NP_001826.3
NM_007098.3	3326	UTR 3			NP_009029.3
XM_011530401.2	3326	UTR 3			XP_011528703.1
XM_017028953.1	3326	UTR 3			XP_016884442.1
XM_017028954.1	3326	UTR 3			XP_016884443.1
XM_017028955.1	3326	UTR 3			XP_016884444.1
XM_017028956.1	3326	UTR 3			XP_016884445.1
XM_017028957.1	3326	Intron			XP_016884446.1

Gene: LINC01311
Gene Name: long intergenic non-protein coding RNA 1311

There are no transcripts associated with this gene.

Gene: SLC25A1
Gene Name: solute carrier family 25 member 1

There are no transcripts associated with this gene.

View Full Product Details