Product Details

SNP ID: rs1075496
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.6:30690462 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CCTGGGGAAGAGGATTTATAGAACA[A/C]CACATGTTAGGCAGTTGCAAAAAGC
Phenotype: MIM: 607593 MIM: 610990
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: MDC1 PubMed Links

Gene Details

Gene: MDC1
Gene Name: mediator of DNA damage checkpoint 1

There are no transcripts associated with this gene.

Gene: NRM
Gene Name: nurim (nuclear envelope membrane protein)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270707.1	369	Intron			NP_001257636.1
NM_001270708.1	369	Intron			NP_001257637.1
NM_001270709.1	369	Intron			NP_001257638.1
NM_001270710.1	369	Intron			NP_001257639.1
NM_007243.2	369	Intron			NP_009174.1
XM_017010224.1	369	UTR 5			XP_016865713.1
XM_017010225.1	369	Intron			XP_016865714.1

Gene: PPP1R18
Gene Name: protein phosphatase 1 regulatory subunit 18

There are no transcripts associated with this gene.

View Full Product Details