Product Details

SNP ID: rs1059004
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:33028155 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTAGAACTCATCCGACCCCCGACC[A/C]CCACCTCCGGGAAAAGATTCTAAAA
Phenotype: MIM: 606386
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: OLIG2 PubMed Links
Additional Information: For this assay, SNP(s) [rs6517136] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005806.3	1681	UTR 3			NP_005797.1
XM_005260908.1	1681	UTR 3			XP_005260965.1