Product Details

SNP ID
rs5746851
Assay Type
Validated
NCBI dbSNP Submissions
NA
Location
Chr.22:20020096 on Build GRCh38
Set Membership
HapMap Validated
Context Sequence [VIC/FAM]
CCTAGGTCTTCAACACAGGTTGAAG[T/C]TAATGTGGCCTCTCTTGCTTGCCAC
Phenotype
MIM: 602269 MIM: 616830
Polymorphism
T/C, Transition Substitution
Allele Nomenclature
Literature Links
ARVCF PubMed Links
Additional Information
For this assay, SNP(s) [rs7288996] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ARVCF
Gene Name
armadillo repeat gene deleted in velocardiofacial syndrome
There are no transcripts associated with this gene.

Gene
TANGO2
Gene Name
transport and golgi organization 2 homolog
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001283106.2 Intron NP_001270035.1
NM_001283116.2 Intron NP_001270045.1
NM_001283129.2 Intron NP_001270058.1
NM_001283148.2 Intron NP_001270077.1
NM_001283154.2 Intron NP_001270083.1
NM_001283179.2 Intron NP_001270108.1
NM_001283186.2 Intron NP_001270115.1
NM_001283199.2 Intron NP_001270128.1
NM_001283215.2 Intron NP_001270144.1
NM_001283235.2 Intron NP_001270164.1
NM_001283248.2 Intron NP_001270177.1
NM_001322141.1 Intron NP_001309070.1
NM_001322142.1 Intron NP_001309071.1
NM_001322143.1 Intron NP_001309072.1
NM_001322144.1 Intron NP_001309073.1
NM_001322145.1 Intron NP_001309074.1
NM_001322146.1 Intron NP_001309075.1
NM_001322147.1 Intron NP_001309076.1
NM_001322148.1 Intron NP_001309077.1
NM_001322149.1 Intron NP_001309078.1
NM_001322150.1 Intron NP_001309079.1
NM_001322153.1 Intron NP_001309082.1
NM_001322155.1 Intron NP_001309084.1
NM_001322160.1 Intron NP_001309089.1
NM_001322163.1 Intron NP_001309092.1
NM_001322166.1 Intron NP_001309095.1
NM_001322167.1 Intron NP_001309096.1
NM_001322169.1 Intron NP_001309098.1
NM_001322171.1 Intron NP_001309100.1
NM_001322172.1 Intron NP_001309101.1
NM_001322173.1 Intron NP_001309102.1
NM_001322174.1 Intron NP_001309103.1
NM_001322175.1 Intron NP_001309104.1
NM_152906.6 Intron NP_690870.3
XM_011529863.1 Intron XP_011528165.1
XM_011529865.1 Intron XP_011528167.1
XM_011529867.1 Intron XP_011528169.1
XM_017028577.1 Intron XP_016884066.1
XM_017028578.1 Intron XP_016884067.1
XM_017028579.1 Intron XP_016884068.1
XM_017028580.1 Intron XP_016884069.1
XM_017028581.1 Intron XP_016884070.1
XM_017028582.1 Intron XP_016884071.1
XM_017028583.1 Intron XP_016884072.1
XM_017028584.1 Intron XP_016884073.1
XM_017028585.1 Intron XP_016884074.1
XM_017028586.1 Intron XP_016884075.1
XM_017028587.1 Intron XP_016884076.1
XM_017028588.1 Intron XP_016884077.1

View Full Product Details