Product Details

SNP ID: rs3744358
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:35009895 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TTTACAGAGGAACTGAGTAGCTGAA[G/T]GAATGATCCTTTGCTAATTGGTAGG
Phenotype: MIM: 600940 MIM: 609735
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: LIG3 PubMed Links

Gene Details

Gene: LIG3
Gene Name: DNA ligase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002311.4	3338	Intron			NP_002302.2
NM_013975.3	3338	Intron			NP_039269.2
XM_005257970.3	3338	Intron			XP_005258027.1
XM_006721896.3	3338	Intron			XP_006721959.1
XM_017024624.1	3338	Intron			XP_016880113.1

Gene: RAD51L3-RFFL
Gene Name: RAD51L3-RFFL readthrough

There are no transcripts associated with this gene.

Gene: RFFL
Gene Name: ring finger and FYVE-like domain containing E3 ubiquitin protein ligase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001017368.1	3338	UTR 3			NP_001017368.1

View Full Product Details