Product Details
- SNP ID
-
rs17609338
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:14073401 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCTGAAGTCTTAAGTAATGGTTTTA[G/T]GTACAATAGGGAACAGAGTAGAGAT
- Phenotype
-
MIM: 602125
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
COX10
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs540470506,rs77328029] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- COX10
- Gene Name
- COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001303.3 |
|
Intron |
|
|
NP_001294.2 |
- Gene
- COX10-AS1
- Gene Name
- COX10 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details