Product Details
- SNP ID
-
rs11056198
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:14832271 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTTCTATTATTTTTCTCTCATTCCC[A/G]TACACTGGCATCCTTGCTGTTGCTT
- Phenotype
-
MIM: 110600
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ART4
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs11056197] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ART4
- Gene Name
- ADP-ribosyltransferase 4 (Dombrock blood group)
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_021071.2 |
|
Intron |
|
|
NP_066549.2 |
- Gene
- C12orf60
- Gene Name
- chromosome 12 open reading frame 60
There are no transcripts associated with this gene.
View Full Product Details