Product Details

SNP ID

rs11754998

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.6:152123929 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGACTACCCTAATATCGGTGGGGGA[A/T]GCGGAGTGACACCTAAGAAAATAAA

Phenotype

MIM: 608441

Polymorphism

A/T, Transversion Substitution

Allele Nomenclature

Literature Links

SYNE1 PubMed Links

Additional Information

For this assay, SNP(s) [rs77765070] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

SYNE1

Gene Name

spectrin repeat containing nuclear envelope protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033071.3		Intron			NP_149062.1
NM_182961.3		Intron			NP_892006.3
XM_006715407.1		Intron			XP_006715470.1
XM_006715408.2		Intron			XP_006715471.1
XM_006715409.1		Intron			XP_006715472.1
XM_006715410.2		Intron			XP_006715473.1
XM_006715411.1		Intron			XP_006715474.1
XM_006715412.2		Intron			XP_006715475.1
XM_006715413.2		Intron			XP_006715476.1
XM_006715414.1		Intron			XP_006715477.1
XM_006715415.2		Intron			XP_006715478.1
XM_006715416.2		Intron			XP_006715479.1
XM_006715417.2		Intron			XP_006715480.1
XM_006715420.2		Intron			XP_006715483.1
XM_006715421.2		Intron			XP_006715484.1
XM_006715422.1		Intron			XP_006715485.1
XM_006715423.2		Intron			XP_006715486.1
XM_006715424.2		Intron			XP_006715487.1
XM_006715425.2		Intron			XP_006715488.1
XM_011535641.2		Intron			XP_011533943.1
XM_011535642.2		Intron			XP_011533944.1
XM_011535643.1		Intron			XP_011533945.1
XM_011535644.1		Intron			XP_011533946.1
XM_011535645.2		Intron			XP_011533947.1
XM_017010608.1		Intron			XP_016866097.1
XM_017010609.1		Intron			XP_016866098.1
XM_017010610.1		Intron			XP_016866099.1
XM_017010611.1		Intron			XP_016866100.1
XM_017010612.1		Intron			XP_016866101.1
XM_017010613.1		Intron			XP_016866102.1
XM_017010614.1		Intron			XP_016866103.1
XM_017010615.1		Intron			XP_016866104.1
XM_017010616.1		Intron			XP_016866105.1
XM_017010617.1		Intron			XP_016866106.1
XM_017010618.1		Intron			XP_016866107.1
XM_017010619.1		Intron			XP_016866108.1

View Full Product Details