Product Details

SNP ID: rs11864839
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:31083930 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCGCCATGACAGATGAGAATACTGA[C/G]GCTCAAAGCGGTTGAGCAGCCTGCT
Phenotype: MIM: 610561 MIM: 608547
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: PRSS53 PubMed Links

Gene Details

Gene: PRSS53
Gene Name: protease, serine 53

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039503.2	3057	Intron			NP_001034592.1
XM_011545816.1	3057	Intron			XP_011544118.1
XM_011545817.1	3057	UTR 3			XP_011544119.1
XM_011545818.2	3057	Intron			XP_011544120.1
XM_011545819.1	3057	Intron			XP_011544121.1
XM_011545820.1	3057	UTR 3			XP_011544122.1

Gene: VKORC1
Gene Name: vitamin K epoxide reductase complex subunit 1

There are no transcripts associated with this gene.

Gene: ZNF646
Gene Name: zinc finger protein 646

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014699.3	3057	Intron			NP_055514.3
XM_005255710.3	3057	Intron			XP_005255767.1
XM_005255711.3	3057	Intron			XP_005255768.1
XM_005255712.3	3057	Intron			XP_005255769.1
XM_011545990.2	3057	Intron			XP_011544292.1

Gene: ZNF668
Gene Name: zinc finger protein 668

There are no transcripts associated with this gene.

View Full Product Details