Product Details

SNP ID

rs1046200

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.16:86531065 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

TCGAGGCATCGTAATGTGCTTCAAA[G/T]AACACTTGGTAAAACCCTCTGGCTA

Phenotype

MIM: 616820

Polymorphism

G/T, Transversion Substitution

Allele Nomenclature

Literature Links

MTHFSD PubMed Links

Additional Information

For this assay, SNP(s) [rs79663301] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MTHFSD

Gene Name

methenyltetrahydrofolate synthetase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001159377.1	2149	UTR 3			NP_001152849.1
NM_001159378.1	2149	UTR 3			NP_001152850.1
NM_001159379.1	2149	UTR 3			NP_001152851.1
NM_001159380.1	2149	UTR 3			NP_001152852.1
NM_022764.2	2149	UTR 3			NP_073601.2
XM_005256101.1	2149	UTR 3			XP_005256158.1
XM_005256105.1	2149	UTR 3			XP_005256162.1
XM_005256106.1	2149	UTR 3			XP_005256163.1
XM_006721247.3	2149	UTR 3			XP_006721310.1
XM_011523280.2	2149	UTR 3			XP_011521582.1
XM_011523282.2	2149	Intron			XP_011521584.1
XM_011523283.2	2149	Intron			XP_011521585.1
XM_011523284.2	2149	Intron			XP_011521586.1
XM_011523285.1	2149	UTR 3			XP_011521587.1
XM_011523286.1	2149	UTR 3			XP_011521588.1
XM_011523287.1	2149	UTR 3			XP_011521589.1
XM_011523288.1	2149	UTR 3			XP_011521590.1
XM_011523289.1	2149	UTR 3			XP_011521591.1
XM_017023571.1	2149	UTR 3			XP_016879060.1
XM_017023572.1	2149	UTR 3			XP_016879061.1
XM_017023573.1	2149	UTR 3			XP_016879062.1
XM_017023574.1	2149	UTR 3			XP_016879063.1

View Full Product Details