Product Details

SNP ID

rs35170134

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.19:36544349 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ATTTTATTCATTAATTTATTATTTG[G/T]TAATGACTTCAAAAAGTAAAAGCCA

Phenotype

Polymorphism

G/T, Transversion Substitution

Allele Nomenclature

Literature Links

ZNF529 PubMed Links

Additional Information

For this assay, SNP(s) [rs76165526] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZNF529

Gene Name

zinc finger protein 529

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145649.1	4411	UTR 3			NP_001139121.1
NM_001145650.1	4411	UTR 3			NP_001139122.1
NM_001321351.1	4411	UTR 3			NP_001308280.1
NM_020951.4	4411	UTR 3			NP_066002.3
XM_006723302.3	4411	UTR 3			XP_006723365.1
XM_006723304.2	4411	UTR 3			XP_006723367.1
XM_011527164.2	4411	UTR 3			XP_011525466.1
XM_011527165.2	4411	UTR 3			XP_011525467.1
XM_011527166.2	4411	UTR 3			XP_011525468.1
XM_011527167.2	4411	UTR 3			XP_011525469.1
XM_011527169.2	4411	Intron			XP_011525471.1
XM_011527170.1	4411	Intron			XP_011525472.1
XM_017027039.1	4411	UTR 3			XP_016882528.1
XM_017027040.1	4411	UTR 3			XP_016882529.1
XM_017027041.1	4411	UTR 3			XP_016882530.1
XM_017027042.1	4411	UTR 3			XP_016882531.1
XM_017027043.1	4411	UTR 3			XP_016882532.1
XM_017027044.1	4411	UTR 3			XP_016882533.1
XM_017027045.1	4411	UTR 3			XP_016882534.1

View Full Product Details