Product Details

SNP ID: rs13167710
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:176393317 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGAGGTTCCTGACACCTAAAGACC[T/C]TTGGAGGTCCTAGGACGACCTAATG
Phenotype: MIM: 118970 MIM: 612861
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: ARL10 PubMed Links

Gene Details

Gene: ARL10
Gene Name: ADP ribosylation factor like GTPase 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317948.1		Intron			NP_001304877.1
NM_173664.5		Intron			NP_775935.1
XM_011534529.2		Intron			XP_011532831.1
XM_011534530.2		Intron			XP_011532832.1
XM_011534531.2		Intron			XP_011532833.1
XM_017009372.1		Intron			XP_016864861.1

Gene: CLTB
Gene Name: clathrin light chain B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001834.3		Intron			NP_001825.1
NM_007097.3		Intron			NP_009028.1
XM_017009026.1		Intron			XP_016864515.1
XM_017009027.1		Intron			XP_016864516.1

Gene: HIGD2A
Gene Name: HIG1 hypoxia inducible domain family member 2A

There are no transcripts associated with this gene.

Gene: NOP16
Gene Name: NOP16 nucleolar protein

There are no transcripts associated with this gene.

View Full Product Details