Product Details

SNP ID: rs2799079
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:28267398 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTGTGGATCTGGTAAACAGAGTAC[A/C]ACCTTCTGCTGCATATTTTTCATCC
Phenotype: MIM: 611643 MIM: 616474
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: NKAPL PubMed Links

Gene Details

Gene: NKAPL
Gene Name: NFKB activating protein like

There are no transcripts associated with this gene.

Gene: ZKSCAN4
Gene Name: zinc finger with KRAB and SCAN domains 4

There are no transcripts associated with this gene.

Gene: ZSCAN26
Gene Name: zinc finger and SCAN domain containing 26

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001023560.3	40	Intron			NP_001018854.2
NM_001111039.2	40	Intron			NP_001104509.1
NM_001287421.1	40	UTR 5			NP_001274350.1
NM_001287422.1	40	Intron			NP_001274351.1
NM_152736.5	40	Intron			NP_689949.3
XM_011514862.2	40	UTR 5			XP_011513164.1
XM_011514864.1	40	UTR 5			XP_011513166.1
XM_011514866.1	40	Intron			XP_011513168.1
XM_011514867.1	40	Intron			XP_011513169.1
XM_011514869.1	40	UTR 5			XP_011513171.1
XM_017011264.1	40	UTR 5			XP_016866753.1
XM_017011265.1	40	Intron			XP_016866754.1

View Full Product Details