Product Details

SNP ID: rs11600990
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64315335 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAAGGTCTTCAGGTTAACTCAGTGA[C/T]GGTAGCACAGCCCCATTTTGCAGAT
Phenotype: MIM: 601998 MIM: 606583
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ESRRA PubMed Links

Gene Details

Gene: ESRRA
Gene Name: estrogen related receptor alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282450.1		Intron			NP_001269379.1
NM_001282451.1		Intron			NP_001269380.1
NM_004451.4		Intron			NP_004442.3
XM_017017313.1		Intron			XP_016872802.1

Gene: PRDX5
Gene Name: peroxiredoxin 5

There are no transcripts associated with this gene.

Gene: TRMT112
Gene Name: tRNA methyltransferase 11-2 homolog (S. cerevisiae)

There are no transcripts associated with this gene.

View Full Product Details