Product Details

SNP ID: rs542407
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:120464204 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAAGAGCCAGCAATACCTATGGTCC[C/T]TTCTCCATGATCACTTAAATCCTGA
Phenotype: MIM: 601562 MIM: 601943
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DYNLL1 PubMed Links

Gene Details

Gene: DYNLL1
Gene Name: dynein light chain LC8-type 1

There are no transcripts associated with this gene.

Gene: GATC
Gene Name: glutamyl-tRNA amidotransferase subunit C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_176818.2		Intron			NP_789788.1

Gene: SRSF9
Gene Name: serine and arginine rich splicing factor 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003769.2		Intron			NP_003760.1

View Full Product Details